DOI: https://doi.org/10.14710/jvsar.v%25vi%25i.866

Active Cytomegalovirus Infection in Critically Ill Immunocompeten Patients Admitted in the ICU. A Molecular Diagnosis Approach

Faculty of Medicine Diponegoro University, Indonesia

Received: 14 Dec 2016; Published: 23 Jun 2017.
Open Access Copyright (c) 2017 Journal of Biomedicine and Translational Research

Citation Format:
Abstract

Background: Active Cytomegalovirus (CMV) infection has long been related to immunocompromised conditions such as malignancy, HIV-AIDS, longterm use of corticosteroids and organ transplantation. Nowadays, several studies showed that active CMV infection also frequently found in formerly immunocompetent patients during critically ill condition. Alteration of immune system in critically ill condition might become the most possible reason enderlying this adverse event.

Aim: To document the prevalence of active CMV infection in critically ill immunocompetent patient admitted to ICU and to find out the difference of the disease severity between group of patients with and without active CMV infection.

Method: This was a cross sectional study. Study conducted from April 1st - June 30th 2013. Subjects were patient aged ≥14 years, hospitalized in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients who had history of malignancy, HIV-AIDS, use of corticosteroids and organ transplatation were excluded from the study. Disease severity was calculated using APACHE II score in the first 24 hours of ICU admission. EDTA sample for qualitative PCR examination (procedure as described elsewhere) collected after 4 days of ICU admission. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Datas were analyzed using bivariate analysis.

Result: Active CMV infection was detected in 16 out of 50 subjects. Mean score of disease severity in all subjects (based on APACHE II scoring system) was 11.8±6.43. Mean score of disease severity in group with active CMV infection was higher than group without active CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510).

Conclusion: The prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Degree of disease severity might influence the occurance of CMV infection. Qualitative PCR testing was an aqurate tool for diagnosing active CMV infection.

Note: This article has supplementary file(s).

Fulltext View|Download |  Research Instrument
Untitled
Subject
Type Research Instrument
  Download (35KB)    Indexing metadata
Keywords: immunocompetent; critically ill; active CMV infection; PCR

Article Metrics:

Article Info
Section: Original Research Articles
Language : EN
Recent articles
Comparison of Effects on Gene Expression Activity of Low-Molecular-Weight Lychee Fruit Polyphenol (Oligonol®), Adenosine, and Minoxidil in Human Dermal Papilla Cells Multidisciplinary Management of Disorders of Sex Development in Indonesia, A Prototype in Developing Country Comparison of Prostaglandin Analogue and Selective Laser Trabeculoplasty Capability to Maintain Intraocular Pressure Fluctuation on Primary Open Angle Glaucoma CHARGE Syndrome: An Indonesian Case Report More recent articles
  1. Morris AC, Kefala K, Wilkinson TS, Dhaliwal K, Farrel L, et al. C5a mediates peripheral blood neutrophil dysfunction in critically ill patient. Am J Respir Crit Care Med 2009;180:19-28
  2. Limaye AP, Kirby KA, Rubenfeld GD, Leisenring WM, Bulger EM, et al. Cytomegalovirus reactivation in critically ill immunocompetent patient. JAMA 2008;300(4):413–22
  3. Osawa R, Singh N. Cytomegalovirus infection in critically ill patient: a systematic review. Critical Care 2009;13(3):1-10
  4. Bhatia J, Shah BV, Mehta AP, Deshmukh M, Sirsat RA, et al. Comparing serology, antigenemia assay and polymerase chain reaction for the diagnosis of Cytomegalovirus infection in renal transplant patients. JAPI 2004;52:297-300
  5. Cohen JI. CMV in ICU: pathogen or passenger? Crit Care Med 2009;37(6):2095–6
  6. Tang CH, Yang CM, Chuang CY, Chang ML, Huang YC, et al. Comparative study of clinical severity scoring systems in ICU in Taiwan. Tzu Chi Med J 2005;17(4):239-45
  7. Safavi M, Honarmand A. Comparison of infection probability score, APACHE II, and APACHE III scoring systems in predicting need for ventilator and ventilation duration in critically ill patients. Arch Iranian Med 2007;10(3):354-60
  8. Le Gall JR. The use of severity scores in the intensive care unit. Intensive Care Med 2005;31:1618-23
  9. Muller, Klemm A, Weiss M, Schneider M, Wiedeck HS, et al. Active Cytomegalovirus infection in patients with septic shock. Emerging Infectious Diseases 2006;12(10):1517-22
  10. Frost P, Wise MP. Recognition and early management of the critically ill ward patient. British Journal of Hospital Medicine 2007;68(10):M180-3
  11. Taylor GH. Cytomegalovirus. Am Fam Physician 2003;67(3):519-24
  12. Rafailidis PI, Mourtzoukou EG, Varbobitis IC, Falagas ME. Severe Cytomegalovirus infection in apparently immunocompetent patients: a systematic review. Virology Journal 2008; 5(47):1-7
  13. Varani S, Landini MP. Cytomegalovirus-induced immunopathology and its clinical consequences. Herpesviridae 2011; 2(6): 1-
  14. Jain M, Duggal S, Chugh TD. Cytomegalovirus infection in non-immunosupressed critically ill patient. J Infect Dev Ctries 2011; 5(8): 571-9
  15. Cook CH, Trgovcich J. Cytomegalovirus reactivation in critically ill immunocompetent hosts: a decade of progress and remaining challenges. Antiviral Res 2011; 90(3) 151-9
  16. Heininger A, Haeberle H, Fischer I, Beck R, Riessen R, et al. Cytomegalovirus reactivation and associated outcome of critically ill patients with severe sepsis. Critical Care 2011;15:1-10

Last update:

No citation recorded.

Last update:

No citation recorded.